Sars-Cov-2, the virus that causes Covid-19 is easily the most defining feature of 2020. In the last 8 months the world has changed radically and there have been plenty of fumbles as countries struggle to deal with the chaos. One of the most important issues has been testing for the virus. In this video, I aim to demystify how that testing actually works down to the chemical level and show exactly how it's done. We'll be covering the viruses anatomy, as well as three types of test: PCR, LAMP and Antibody.
Earlier videos:
PCR - [ Ссылка ]
Gel Electrophoresis - [ Ссылка ]
___________________________________________________________________
Try tab for a cause today:
[ Ссылка ]
___________________________________________________________________
00:00 - Introduction
04:00 - Virus Anatomy Overview
09:45 - PCR Overview
13:30 - Performing PCR
20:37 - Testing at Scale and Robots (Opentrons)
23:30 - LAMP overview
27:50 - Performing LAMP (Biofoundry)
30:30 - Pros/Cons of Genetic Tests
31:30 - Antibody Overview
32:50 - Performing Antibody Test
34:00 - How Antibody Tests Work
38:00 - Summary
____________________________________________________________________
Support the show and future projects:
Patreon: [ Ссылка ]
Nebula: [ Ссылка ]
Ko-Fi: [ Ссылка ]
Become a member: [ Ссылка ]
Store: [ Ссылка ]
______________________________________________________
Our Social Media Pages:
Tiktok: [ Ссылка ]
Instagram: [ Ссылка ]
Facebook: [ Ссылка ]
Twitter: [ Ссылка ]
Website: [ Ссылка ]
_____________________________________________________
More resources, and citations:
Kurzgesagt Covid Overview: [ Ссылка ]
A great writeup about the virus's anatomy: [ Ссылка ]
JOGL: [ Ссылка ]
Biofoundry: [ Ссылка ]
Student Outbreak: [ Ссылка ]
Student Outbreak 2: [ Ссылка ]
Strokes In heathy people: [ Ссылка ]
Organ Damage: [ Ссылка ]
Aptamer Tests: [ Ссылка ]
Variations in Test Accuracy: [ Ссылка ]
Faulty probes: [ Ссылка ]
Contaminated Swabs: [ Ссылка ]
False positives FDA: [ Ссылка ]
E protein structure: [ Ссылка ]
MERS fact sheet: [ Ссылка ]
Incidence of thromboembolism: [ Ссылка ]
Stroke study: [ Ссылка ]
Stroke 2: [ Ссылка ]
Cardiac infection: [ Ссылка ]
Asymptomatic infection rate: [ Ссылка ]
Asymptomatic infection study: [ Ссылка ]
Organ damage in asymptomatic pateints: [ Ссылка ]
Wisconsin LAMP trial: [ Ссылка ]
Healthy people stroke: [ Ссылка ]
LAMP Assay design: [ Ссылка ]
Mutation geneology: [ Ссылка ]
Cardiac outcomes: [ Ссылка ]
False negative rate: [ Ссылка ]
ACE2 distribution: [ Ссылка ]
Long Haulers article: [ Ссылка ]
Long haulers Video: [ Ссылка ]
Complete protein models: [ Ссылка ]
Antibody test: [ Ссылка ]
_________________________________________________________________________________
Right after this video went up, one of my awesome friends Sebastian designed new primers which are much much better than the CDC or other primers used in this video. Here are their sequences for those interested and if you'd like, check out Sebastian's work here: [ Ссылка ]
SpikeF - AGGAATTTTTATGAACCACAAATCA
MembraneR - CGGTGATCCAATTTATTCTGTAAAC
NucleoF - AAATGAAAGATCTCAGTCCAAGATG
NucleoR - ACAGTTTGCTGTTTCTTCTGTCTCT
Original Primers:
N1F - GACCCCAAAATCAGCGAAAT
N2F - ttacaaacattggccgcaaa
N3F - GGGAGCCTTGAATACACCAAAA
N2R - GCGCGACATTCCGAAGAA
N2-LF - gggggcaaattgtgcaatttg
N2-B3 - gacttgatctttgaaatttggatct
N2-F3 - accaggaactaatcagacaag
